Review



lentiviral constructs plko rfp shctrl  (Addgene inc)


Bioz Verified Symbol Addgene inc is a verified supplier  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 93

    Structured Review

    Addgene inc lentiviral constructs plko rfp shctrl
    a , Experimental design of biotinylation assays in cortical neurons under basal, cLTP and post-cLTP conditions. b , A representative αFLAG immunofluorescence image of cortical neurons expressing FLAG-APEX2 fused to a nuclear export signal sequence from a <t>lentiviral</t> vector. c , Proteomic analysis of streptavidin pulldown and input samples from cortical neurons subject to biotin labelling under basal conditions. d , Pulldown to input ratios as a function of the predicted number of surface tyrosines per protein. e , Volcano plot with enrichment scores for the indicated selection of protein sets (bubble size indicates protein number in each protein set). f , Tyrosine surface exposure in ribosomal proteins with low and high accessibility scores as determined by their streptavidin pulldown / input ratios. g , Accessibility scores corresponding to ribosomal proteins as a function of the number of surface tyrosines hidden in the 80S ribosome under basal (blue) and cLTP (orange) conditions. h , Proteomic analysis of cortical neurons under basal and cLTP conditions. Ribosomal proteins are indicated (red dots).
    Lentiviral Constructs Plko Rfp Shctrl, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 7 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/lentiviral+constructs+plko+rfp+shctrl/pLKO-RFP-shCntrl+(Plasmid+%2369040)/bio_rxiv__2025__07__16__665171-165-0-3
    Average 93 stars, based on 7 article reviews
    lentiviral constructs plko rfp shctrl - by Bioz Stars, 2026-09
    93/100 stars

    Images

    1) Product Images from "Concerted remodelling of the postsynaptic spine and RNA granule by cLTP"

    Article Title: Concerted remodelling of the postsynaptic spine and RNA granule by cLTP

    Journal: bioRxiv

    doi: 10.1101/2025.07.16.665171

    a , Experimental design of biotinylation assays in cortical neurons under basal, cLTP and post-cLTP conditions. b , A representative αFLAG immunofluorescence image of cortical neurons expressing FLAG-APEX2 fused to a nuclear export signal sequence from a lentiviral vector. c , Proteomic analysis of streptavidin pulldown and input samples from cortical neurons subject to biotin labelling under basal conditions. d , Pulldown to input ratios as a function of the predicted number of surface tyrosines per protein. e , Volcano plot with enrichment scores for the indicated selection of protein sets (bubble size indicates protein number in each protein set). f , Tyrosine surface exposure in ribosomal proteins with low and high accessibility scores as determined by their streptavidin pulldown / input ratios. g , Accessibility scores corresponding to ribosomal proteins as a function of the number of surface tyrosines hidden in the 80S ribosome under basal (blue) and cLTP (orange) conditions. h , Proteomic analysis of cortical neurons under basal and cLTP conditions. Ribosomal proteins are indicated (red dots).
    Figure Legend Snippet: a , Experimental design of biotinylation assays in cortical neurons under basal, cLTP and post-cLTP conditions. b , A representative αFLAG immunofluorescence image of cortical neurons expressing FLAG-APEX2 fused to a nuclear export signal sequence from a lentiviral vector. c , Proteomic analysis of streptavidin pulldown and input samples from cortical neurons subject to biotin labelling under basal conditions. d , Pulldown to input ratios as a function of the predicted number of surface tyrosines per protein. e , Volcano plot with enrichment scores for the indicated selection of protein sets (bubble size indicates protein number in each protein set). f , Tyrosine surface exposure in ribosomal proteins with low and high accessibility scores as determined by their streptavidin pulldown / input ratios. g , Accessibility scores corresponding to ribosomal proteins as a function of the number of surface tyrosines hidden in the 80S ribosome under basal (blue) and cLTP (orange) conditions. h , Proteomic analysis of cortical neurons under basal and cLTP conditions. Ribosomal proteins are indicated (red dots).

    Techniques Used: Immunofluorescence, Expressing, Sequencing, Plasmid Preparation, Selection

    Related Articles

    Construct:

    Article Title: Concerted remodelling of the postsynaptic spine and RNA granule by cLTP
    Article Snippet: Animal experimental procedures were approved by the ethics committee of the National Research Council of Spain (Approval number: B9900083). .. Lentiviral constructs pLKO-RFP-shCtrl (Addgene, 69040) and pLKO-RFP-shDbn1 containing the shRNA sequence GCAGTCTATCTTTGGTGACCA (TRCN0000090077) against the Dbn1 gene were used in knockdown experiments. pFUW-FLAG-APEX2, pFUW-FLAG-APEX2-DBN1 and pFUW-FLAG-APEX2-IGF2BP1 were used to perform accessibility and proximity assays, and derived from pcDNA3 APEX2-NES (Addgene, 49386) and pFUW (Addgene, 14882). .. Dbn1, Dbn1 ΔIDR and Igf2bp1 were amplified using Phusion High-Fidelity DNA Polymerase (Thermo Fisher, 10024537) from mouse cDNAs. mEGFP-C3 (Clontech) and mScarlet-C1 (Addgene, 85044) were used as host vectors.

    shRNA:

    Article Title: Concerted remodelling of the postsynaptic spine and RNA granule by cLTP
    Article Snippet: Animal experimental procedures were approved by the ethics committee of the National Research Council of Spain (Approval number: B9900083). .. Lentiviral constructs pLKO-RFP-shCtrl (Addgene, 69040) and pLKO-RFP-shDbn1 containing the shRNA sequence GCAGTCTATCTTTGGTGACCA (TRCN0000090077) against the Dbn1 gene were used in knockdown experiments. pFUW-FLAG-APEX2, pFUW-FLAG-APEX2-DBN1 and pFUW-FLAG-APEX2-IGF2BP1 were used to perform accessibility and proximity assays, and derived from pcDNA3 APEX2-NES (Addgene, 49386) and pFUW (Addgene, 14882). .. Dbn1, Dbn1 ΔIDR and Igf2bp1 were amplified using Phusion High-Fidelity DNA Polymerase (Thermo Fisher, 10024537) from mouse cDNAs. mEGFP-C3 (Clontech) and mScarlet-C1 (Addgene, 85044) were used as host vectors.

    Sequencing:

    Article Title: Concerted remodelling of the postsynaptic spine and RNA granule by cLTP
    Article Snippet: Animal experimental procedures were approved by the ethics committee of the National Research Council of Spain (Approval number: B9900083). .. Lentiviral constructs pLKO-RFP-shCtrl (Addgene, 69040) and pLKO-RFP-shDbn1 containing the shRNA sequence GCAGTCTATCTTTGGTGACCA (TRCN0000090077) against the Dbn1 gene were used in knockdown experiments. pFUW-FLAG-APEX2, pFUW-FLAG-APEX2-DBN1 and pFUW-FLAG-APEX2-IGF2BP1 were used to perform accessibility and proximity assays, and derived from pcDNA3 APEX2-NES (Addgene, 49386) and pFUW (Addgene, 14882). .. Dbn1, Dbn1 ΔIDR and Igf2bp1 were amplified using Phusion High-Fidelity DNA Polymerase (Thermo Fisher, 10024537) from mouse cDNAs. mEGFP-C3 (Clontech) and mScarlet-C1 (Addgene, 85044) were used as host vectors.

    Knockdown:

    Article Title: Concerted remodelling of the postsynaptic spine and RNA granule by cLTP
    Article Snippet: Animal experimental procedures were approved by the ethics committee of the National Research Council of Spain (Approval number: B9900083). .. Lentiviral constructs pLKO-RFP-shCtrl (Addgene, 69040) and pLKO-RFP-shDbn1 containing the shRNA sequence GCAGTCTATCTTTGGTGACCA (TRCN0000090077) against the Dbn1 gene were used in knockdown experiments. pFUW-FLAG-APEX2, pFUW-FLAG-APEX2-DBN1 and pFUW-FLAG-APEX2-IGF2BP1 were used to perform accessibility and proximity assays, and derived from pcDNA3 APEX2-NES (Addgene, 49386) and pFUW (Addgene, 14882). .. Dbn1, Dbn1 ΔIDR and Igf2bp1 were amplified using Phusion High-Fidelity DNA Polymerase (Thermo Fisher, 10024537) from mouse cDNAs. mEGFP-C3 (Clontech) and mScarlet-C1 (Addgene, 85044) were used as host vectors.

    Derivative Assay:

    Article Title: Concerted remodelling of the postsynaptic spine and RNA granule by cLTP
    Article Snippet: Animal experimental procedures were approved by the ethics committee of the National Research Council of Spain (Approval number: B9900083). .. Lentiviral constructs pLKO-RFP-shCtrl (Addgene, 69040) and pLKO-RFP-shDbn1 containing the shRNA sequence GCAGTCTATCTTTGGTGACCA (TRCN0000090077) against the Dbn1 gene were used in knockdown experiments. pFUW-FLAG-APEX2, pFUW-FLAG-APEX2-DBN1 and pFUW-FLAG-APEX2-IGF2BP1 were used to perform accessibility and proximity assays, and derived from pcDNA3 APEX2-NES (Addgene, 49386) and pFUW (Addgene, 14882). .. Dbn1, Dbn1 ΔIDR and Igf2bp1 were amplified using Phusion High-Fidelity DNA Polymerase (Thermo Fisher, 10024537) from mouse cDNAs. mEGFP-C3 (Clontech) and mScarlet-C1 (Addgene, 85044) were used as host vectors.



    Similar Products

    93
    Addgene inc lentiviral constructs plko rfp shctrl
    a , Experimental design of biotinylation assays in cortical neurons under basal, cLTP and post-cLTP conditions. b , A representative αFLAG immunofluorescence image of cortical neurons expressing FLAG-APEX2 fused to a nuclear export signal sequence from a <t>lentiviral</t> vector. c , Proteomic analysis of streptavidin pulldown and input samples from cortical neurons subject to biotin labelling under basal conditions. d , Pulldown to input ratios as a function of the predicted number of surface tyrosines per protein. e , Volcano plot with enrichment scores for the indicated selection of protein sets (bubble size indicates protein number in each protein set). f , Tyrosine surface exposure in ribosomal proteins with low and high accessibility scores as determined by their streptavidin pulldown / input ratios. g , Accessibility scores corresponding to ribosomal proteins as a function of the number of surface tyrosines hidden in the 80S ribosome under basal (blue) and cLTP (orange) conditions. h , Proteomic analysis of cortical neurons under basal and cLTP conditions. Ribosomal proteins are indicated (red dots).
    Lentiviral Constructs Plko Rfp Shctrl, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/lentiviral+constructs+plko+rfp+shctrl/pLKO-RFP-shCntrl+(Plasmid+%2369040)/bio_rxiv__2025__07__16__665171-165-0-3
    Average 93 stars, based on 1 article reviews
    lentiviral constructs plko rfp shctrl - by Bioz Stars, 2026-09
    93/100 stars
      Buy from Supplier

    Image Search Results


    a , Experimental design of biotinylation assays in cortical neurons under basal, cLTP and post-cLTP conditions. b , A representative αFLAG immunofluorescence image of cortical neurons expressing FLAG-APEX2 fused to a nuclear export signal sequence from a lentiviral vector. c , Proteomic analysis of streptavidin pulldown and input samples from cortical neurons subject to biotin labelling under basal conditions. d , Pulldown to input ratios as a function of the predicted number of surface tyrosines per protein. e , Volcano plot with enrichment scores for the indicated selection of protein sets (bubble size indicates protein number in each protein set). f , Tyrosine surface exposure in ribosomal proteins with low and high accessibility scores as determined by their streptavidin pulldown / input ratios. g , Accessibility scores corresponding to ribosomal proteins as a function of the number of surface tyrosines hidden in the 80S ribosome under basal (blue) and cLTP (orange) conditions. h , Proteomic analysis of cortical neurons under basal and cLTP conditions. Ribosomal proteins are indicated (red dots).

    Journal: bioRxiv

    Article Title: Concerted remodelling of the postsynaptic spine and RNA granule by cLTP

    doi: 10.1101/2025.07.16.665171

    Figure Lengend Snippet: a , Experimental design of biotinylation assays in cortical neurons under basal, cLTP and post-cLTP conditions. b , A representative αFLAG immunofluorescence image of cortical neurons expressing FLAG-APEX2 fused to a nuclear export signal sequence from a lentiviral vector. c , Proteomic analysis of streptavidin pulldown and input samples from cortical neurons subject to biotin labelling under basal conditions. d , Pulldown to input ratios as a function of the predicted number of surface tyrosines per protein. e , Volcano plot with enrichment scores for the indicated selection of protein sets (bubble size indicates protein number in each protein set). f , Tyrosine surface exposure in ribosomal proteins with low and high accessibility scores as determined by their streptavidin pulldown / input ratios. g , Accessibility scores corresponding to ribosomal proteins as a function of the number of surface tyrosines hidden in the 80S ribosome under basal (blue) and cLTP (orange) conditions. h , Proteomic analysis of cortical neurons under basal and cLTP conditions. Ribosomal proteins are indicated (red dots).

    Article Snippet: Lentiviral constructs pLKO-RFP-shCtrl (Addgene, 69040) and pLKO-RFP-shDbn1 containing the shRNA sequence GCAGTCTATCTTTGGTGACCA (TRCN0000090077) against the Dbn1 gene were used in knockdown experiments. pFUW-FLAG-APEX2, pFUW-FLAG-APEX2-DBN1 and pFUW-FLAG-APEX2-IGF2BP1 were used to perform accessibility and proximity assays, and derived from pcDNA3 APEX2-NES (Addgene, 49386) and pFUW (Addgene, 14882).

    Techniques: Immunofluorescence, Expressing, Sequencing, Plasmid Preparation, Selection